ID: 1101432148_1101432156

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1101432148 1101432156
Species Human (GRCh38) Human (GRCh38)
Location 12:104635419-104635441 12:104635454-104635476
Sequence CCCTTAAGAAGATGTAATTGCCG GCAGTCATCTCATCACAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94} {0: 1, 1: 0, 2: 2, 3: 51, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!