ID: 1101436663_1101436674

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1101436663 1101436674
Species Human (GRCh38) Human (GRCh38)
Location 12:104670115-104670137 12:104670143-104670165
Sequence CCACACCGCCTGCTGCAGGGCCT CCTCACAGGGAGAGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 55, 4: 478} {0: 1, 1: 1, 2: 8, 3: 75, 4: 687}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!