ID: 1101436666_1101436674

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1101436666 1101436674
Species Human (GRCh38) Human (GRCh38)
Location 12:104670123-104670145 12:104670143-104670165
Sequence CCTGCTGCAGGGCCTGCTGGCCT CCTCACAGGGAGAGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 530} {0: 1, 1: 1, 2: 8, 3: 75, 4: 687}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!