ID: 1101438455_1101438464

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1101438455 1101438464
Species Human (GRCh38) Human (GRCh38)
Location 12:104684209-104684231 12:104684257-104684279
Sequence CCTTCCTTCTTGAAGGATTACAG TGGATGGATGGATGGATGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 171} {0: 12138, 1: 10577, 2: 16657, 3: 22775, 4: 28470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!