ID: 1101448296_1101448304

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1101448296 1101448304
Species Human (GRCh38) Human (GRCh38)
Location 12:104754109-104754131 12:104754159-104754181
Sequence CCAGTTATTTCCAAGCTGGGAAA GGAACCCGAAAATATATATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 189} {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!