ID: 1101453492_1101453499

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1101453492 1101453499
Species Human (GRCh38) Human (GRCh38)
Location 12:104805188-104805210 12:104805235-104805257
Sequence CCAAAGAAAATGAAAACTTAAGG CACCCAATGCTGTTAGGTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 81, 4: 820} {0: 1, 1: 0, 2: 0, 3: 2, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!