ID: 1101455482_1101455491

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1101455482 1101455491
Species Human (GRCh38) Human (GRCh38)
Location 12:104826412-104826434 12:104826458-104826480
Sequence CCGACAATGTAGGATTGACCTAG AGGCTGCAAGTGGCAAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 20, 4: 120} {0: 1, 1: 0, 2: 12, 3: 65, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!