ID: 1101473729_1101473735

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1101473729 1101473735
Species Human (GRCh38) Human (GRCh38)
Location 12:105023850-105023872 12:105023890-105023912
Sequence CCTAGTAGGTACTCAAGATAATG CATCACAGTGGGTTAAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 147} {0: 1, 1: 0, 2: 4, 3: 16, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!