ID: 1101481931_1101481932

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1101481931 1101481932
Species Human (GRCh38) Human (GRCh38)
Location 12:105106943-105106965 12:105106975-105106997
Sequence CCATTATAAATATATTTCATCTA CTCTTCAGTGATTCGTAGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 98, 4: 1124} {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!