ID: 1101482107_1101482118

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1101482107 1101482118
Species Human (GRCh38) Human (GRCh38)
Location 12:105107986-105108008 12:105108035-105108057
Sequence CCTTGGGGTGTGCGAGGGACGCG GGTCCCAGCCACGGCGGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 295} {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!