ID: 1101486190_1101486191

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1101486190 1101486191
Species Human (GRCh38) Human (GRCh38)
Location 12:105163479-105163501 12:105163501-105163523
Sequence CCATCTTTTTAGCAGTTGAAGTG GTTTTTTTCCTTTCTTTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163} {0: 1, 1: 1, 2: 49, 3: 787, 4: 11326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!