ID: 1101498816_1101498823

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1101498816 1101498823
Species Human (GRCh38) Human (GRCh38)
Location 12:105281798-105281820 12:105281844-105281866
Sequence CCACCTTGTGGCTTGGAAAGGAA AAGGGAAAACAGAAGGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 162} {0: 1, 1: 0, 2: 6, 3: 69, 4: 842}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!