ID: 1101499840_1101499845

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1101499840 1101499845
Species Human (GRCh38) Human (GRCh38)
Location 12:105292934-105292956 12:105292971-105292993
Sequence CCACTTTGGAGTTCTAGTTGGCA TACAGCTTCATATTTACTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 193} {0: 1, 1: 0, 2: 3, 3: 28, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!