|
Left Crispr |
Right Crispr |
| Crispr ID |
1101502664 |
1101502673 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:105318832-105318854
|
12:105318863-105318885
|
| Sequence |
CCAGGCATGGTGGCTCATGCCCG |
GCACTTTAGGAGGCTGAGGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 84, 1: 8789, 2: 40984, 3: 102915, 4: 176127} |
{0: 980, 1: 35772, 2: 141514, 3: 240842, 4: 258836} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|