|
Left Crispr |
Right Crispr |
Crispr ID |
1101502664 |
1101502674 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:105318832-105318854
|
12:105318866-105318888
|
Sequence |
CCAGGCATGGTGGCTCATGCCCG |
CTTTAGGAGGCTGAGGTGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 84, 1: 8789, 2: 40984, 3: 102915, 4: 176127} |
{0: 800, 1: 26400, 2: 83667, 3: 177852, 4: 195160} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|