ID: 1101510336_1101510339

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1101510336 1101510339
Species Human (GRCh38) Human (GRCh38)
Location 12:105387348-105387370 12:105387388-105387410
Sequence CCTCTAGGCAACAGCTTGGGATT TACTGCTAGAGAATTTAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83} {0: 1, 1: 0, 2: 0, 3: 16, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!