ID: 1101511456_1101511464

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1101511456 1101511464
Species Human (GRCh38) Human (GRCh38)
Location 12:105396696-105396718 12:105396749-105396771
Sequence CCACTATGGGTATGGGGTGAGAA CTAATAAGAGGCAGAATTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 91} {0: 1, 1: 0, 2: 0, 3: 19, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!