ID: 1101529374_1101529378

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1101529374 1101529378
Species Human (GRCh38) Human (GRCh38)
Location 12:105560125-105560147 12:105560162-105560184
Sequence CCTCTTCACACTCCATCTGGCAT CTGAAAAATAGAAGGACTCTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!