ID: 1101543959_1101543960

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1101543959 1101543960
Species Human (GRCh38) Human (GRCh38)
Location 12:105692457-105692479 12:105692471-105692493
Sequence CCTAACTCTGTAAAGAATGACAT GAATGACATCGATAACTTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 100, 4: 620} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!