ID: 1101587582_1101587587

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1101587582 1101587587
Species Human (GRCh38) Human (GRCh38)
Location 12:106098548-106098570 12:106098589-106098611
Sequence CCAGTTCCAGCACATCACAATGC TGCAATCTTGCATGGCCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 127} {0: 1, 1: 0, 2: 3, 3: 11, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!