ID: 1101592874_1101592888

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1101592874 1101592888
Species Human (GRCh38) Human (GRCh38)
Location 12:106139115-106139137 12:106139164-106139186
Sequence CCCGGGGCCGGGGCCGCCGTGAG GACTCGCCCTTTGTGCGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 389} {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!