ID: 1101597175_1101597179

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1101597175 1101597179
Species Human (GRCh38) Human (GRCh38)
Location 12:106177814-106177836 12:106177863-106177885
Sequence CCGCCATTAGGGTGGGAAGAGGC AAAGAAATCCCTTTGTGGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!