ID: 1101605147_1101605152

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1101605147 1101605152
Species Human (GRCh38) Human (GRCh38)
Location 12:106242807-106242829 12:106242839-106242861
Sequence CCTGATGAGCTGGTCCATGTCTC CTGTCAGCCCTGACCTGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 179} {0: 1, 1: 1, 2: 0, 3: 26, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!