ID: 1101619886_1101619888

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1101619886 1101619888
Species Human (GRCh38) Human (GRCh38)
Location 12:106375066-106375088 12:106375089-106375111
Sequence CCTCATTCTGAGTGAATACGTAG CAGAATACACAAATCGAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 60} {0: 1, 1: 0, 2: 0, 3: 6, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!