|
Left Crispr |
Right Crispr |
| Crispr ID |
1101622429 |
1101622435 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:106401929-106401951
|
12:106401959-106401981
|
| Sequence |
CCTATTCAACATAGTGTTGGAAG |
CAGGGCAATCAGGCAGTTGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8499, 1: 5117, 2: 3568, 3: 2773, 4: 2158} |
{0: 1, 1: 11, 2: 2856, 3: 4583, 4: 1371} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|