ID: 1101625848_1101625858

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1101625848 1101625858
Species Human (GRCh38) Human (GRCh38)
Location 12:106440448-106440470 12:106440496-106440518
Sequence CCTTCCAGTTCCTGCACAATCTG ACTCCCTGTTTCAACCACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 251} {0: 1, 1: 0, 2: 1, 3: 25, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!