ID: 1101638207_1101638210

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1101638207 1101638210
Species Human (GRCh38) Human (GRCh38)
Location 12:106565108-106565130 12:106565134-106565156
Sequence CCAGTCACTGGGAGCCATAGGTA CTGTGATGGTAGCCACAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 91} {0: 1, 1: 0, 2: 2, 3: 15, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!