|
Left Crispr |
Right Crispr |
| Crispr ID |
1101663421 |
1101663426 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:106787680-106787702
|
12:106787713-106787735
|
| Sequence |
CCCGATAAGCCCATCAGATCCTG |
TCACTACCACGAGAACAGTATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 13, 2: 224, 3: 647, 4: 2214} |
{0: 355, 1: 1864, 2: 3474, 3: 8061, 4: 8465} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|