|
Left Crispr |
Right Crispr |
Crispr ID |
1101663421 |
1101663427 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:106787680-106787702
|
12:106787714-106787736
|
Sequence |
CCCGATAAGCCCATCAGATCCTG |
CACTACCACGAGAACAGTATGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 13, 2: 224, 3: 647, 4: 2214} |
{0: 330, 1: 1790, 2: 3003, 3: 6622, 4: 9295} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|