ID: 1101665721_1101665728

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1101665721 1101665728
Species Human (GRCh38) Human (GRCh38)
Location 12:106811739-106811761 12:106811769-106811791
Sequence CCCATTTCAGCAGCATTCTGTGG GAAGGTATGAAAGGTGTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 201} {0: 1, 1: 0, 2: 0, 3: 19, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!