ID: 1101687197_1101687202

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1101687197 1101687202
Species Human (GRCh38) Human (GRCh38)
Location 12:107036750-107036772 12:107036795-107036817
Sequence CCTACTTCAGTACCTTTGCACAG CATTTCCCTCATACATCCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 90, 4: 507} {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!