ID: 1101733257_1101733265

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1101733257 1101733265
Species Human (GRCh38) Human (GRCh38)
Location 12:107443925-107443947 12:107443949-107443971
Sequence CCCTGTGAACCCTTGCCTTACAG CAGGGTCACCTAGATGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 131} {0: 1, 1: 0, 2: 0, 3: 26, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!