ID: 1101734633_1101734640

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1101734633 1101734640
Species Human (GRCh38) Human (GRCh38)
Location 12:107453859-107453881 12:107453879-107453901
Sequence CCTGGGAATTTGGTACTATTCTG CTGCAAGTAGGGGTGAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 162} {0: 1, 1: 0, 2: 2, 3: 42, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!