ID: 1101738439_1101738453

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1101738439 1101738453
Species Human (GRCh38) Human (GRCh38)
Location 12:107481398-107481420 12:107481450-107481472
Sequence CCTGGTTCCCTCTGAGCACCAGG AGGACTTGGGTCACTGGTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 276} {0: 1, 1: 0, 2: 0, 3: 22, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!