ID: 1101740415_1101740426

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1101740415 1101740426
Species Human (GRCh38) Human (GRCh38)
Location 12:107495620-107495642 12:107495665-107495687
Sequence CCTCTCAGGGCCTGCCCTCCATG AGCCCTTCTGTATCTACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 353} {0: 1, 1: 0, 2: 2, 3: 6, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!