ID: 1101764207_1101764212

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1101764207 1101764212
Species Human (GRCh38) Human (GRCh38)
Location 12:107683258-107683280 12:107683301-107683323
Sequence CCATGATGGCTGGGTCTCAGCTG GTGAATCAATGTCTGGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 33, 4: 250} {0: 1, 1: 0, 2: 2, 3: 13, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!