ID: 1101795227_1101795231

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1101795227 1101795231
Species Human (GRCh38) Human (GRCh38)
Location 12:107966871-107966893 12:107966922-107966944
Sequence CCTCAGCCTCTTGAGTAGCTGAG TCTAAGTTTTAGTAGAAATAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 250, 4: 4075}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!