ID: 1101800048_1101800055

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1101800048 1101800055
Species Human (GRCh38) Human (GRCh38)
Location 12:108013826-108013848 12:108013873-108013895
Sequence CCTTCCTCCTTCAGGTCTTCCAG TTCCCTTCTCTGCACTACTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 22, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!