ID: 1101800929_1101800937

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1101800929 1101800937
Species Human (GRCh38) Human (GRCh38)
Location 12:108021499-108021521 12:108021537-108021559
Sequence CCTTCCTCCTCCTGCTCCTTCAT CTAGAGTTTCCCATGGGAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!