ID: 1101816628_1101816633

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1101816628 1101816633
Species Human (GRCh38) Human (GRCh38)
Location 12:108150817-108150839 12:108150853-108150875
Sequence CCCAGCAGGCACTTGAGCAGACC CTGGAAAAAAGGCCCCTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113} {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!