ID: 1101818121_1101818127

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1101818121 1101818127
Species Human (GRCh38) Human (GRCh38)
Location 12:108161617-108161639 12:108161664-108161686
Sequence CCAGAACCAGGAGAGAATAAATT GTGGTACTCTGTTGGCAGCCCGG
Strand - +
Off-target summary {0: 2, 1: 16, 2: 177, 3: 888, 4: 3162} {0: 1, 1: 0, 2: 0, 3: 13, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!