ID: 1101823294_1101823300

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1101823294 1101823300
Species Human (GRCh38) Human (GRCh38)
Location 12:108200851-108200873 12:108200884-108200906
Sequence CCTTCTGCCCTGGGGAAGCCTAG GAAATTCCATCGCCGGTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 242} {0: 1, 1: 0, 2: 0, 3: 3, 4: 21}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!