ID: 1101825888_1101825897

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1101825888 1101825897
Species Human (GRCh38) Human (GRCh38)
Location 12:108219710-108219732 12:108219742-108219764
Sequence CCCACATTACAGGATAAGAGCTG GGATCCCTGCAAGGGTACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 106} {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!