ID: 1101829077_1101829085

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1101829077 1101829085
Species Human (GRCh38) Human (GRCh38)
Location 12:108243087-108243109 12:108243133-108243155
Sequence CCCTGGAGACACTTGAGTTTGAG CAGTGGCATCAGCATCCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 274} {0: 1, 1: 5, 2: 21, 3: 145, 4: 764}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!