ID: 1101875830_1101875843

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1101875830 1101875843
Species Human (GRCh38) Human (GRCh38)
Location 12:108596593-108596615 12:108596645-108596667
Sequence CCCAGCCCCACCTGCAGTCAGCA TGGACGGCCCCTGCCCTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 40, 4: 365} {0: 1, 1: 0, 2: 2, 3: 24, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!