ID: 1101880613_1101880618

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1101880613 1101880618
Species Human (GRCh38) Human (GRCh38)
Location 12:108623191-108623213 12:108623211-108623233
Sequence CCCCATCAGGCAACAGGGATGAG GAGATGCAGACCATCTCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 186} {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!