ID: 1101889639_1101889644

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1101889639 1101889644
Species Human (GRCh38) Human (GRCh38)
Location 12:108701663-108701685 12:108701687-108701709
Sequence CCCTTCCCCTTTTACAGATAAGA AACTCCAAAGTGAAATTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 25, 3: 144, 4: 675} {0: 1, 1: 0, 2: 0, 3: 28, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!