ID: 1101902896_1101902905

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1101902896 1101902905
Species Human (GRCh38) Human (GRCh38)
Location 12:108804476-108804498 12:108804512-108804534
Sequence CCGTGGAGGTGCACAGAAATCAG GAGCTACAGGACCCGGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 246} {0: 1, 1: 0, 2: 1, 3: 5, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!