ID: 1101910458_1101910478

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1101910458 1101910478
Species Human (GRCh38) Human (GRCh38)
Location 12:108857327-108857349 12:108857373-108857395
Sequence CCGCGCAGCCGCCCCCCTGCCCC GGCCTCGGCGCGGCGTCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 135, 4: 1281} {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!