ID: 1101910459_1101910482

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1101910459 1101910482
Species Human (GRCh38) Human (GRCh38)
Location 12:108857335-108857357 12:108857384-108857406
Sequence CCGCCCCCCTGCCCCGCACGCGC GGCGTCCGGCGGCCCAGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 110, 4: 1052} {0: 1, 1: 0, 2: 0, 3: 36, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!